Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don’t worry about start and stop codons.

Academic Writing Biology Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don’t worry about start and stop codons.

Biology

Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don’t worry about start and stop codons.

Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don’t worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid “Q”)

5′ UCAACUGCGAAUCUGGAAUAU 3′ Transcribed Image Text: 2nd
1st
U
C
3rd
F
U
F
S
Y
U
L
S
*
A
L
S
W
G
L
H
U
L
H
L
Q
A
L
Q
G
T
N
U
A
T
K
A
M
T
K
G
V
A
D
U
A
D
V
A
E
A
V
A
E
G
3R R R RS SRRGG GG
AI> > * *
E> >>>

Ready to try a high quality writing service? Get a discount here