Category: Biology

Heat and moisture loss by respiration in high altitude mount

Biology

Heat and moisture loss by respiration in high altitude mount

Posted By Bruce Simons

Heat and moisture loss by respiration in high altitude mountain climbing. A severe problem encounter… Show more Heat and moisture loss by respiration in high altitude mountain climbing. A severe problem encountered in expedition-type mountain climbing (at elevations 18,000 ft or above) is that, because

Read More
CART therapy is taking lymphocytes from a cancer patient, ge

Biology

CART therapy is taking lymphocytes from a cancer patient, ge

Posted By Bruce Simons

CART therapy is taking lymphocytes from a cancer patient, genetically modifying them in vitro, and t… Show more CART therapy is taking lymphocytes from a cancer patient, genetically modifying them in vitro, and transferring the cells back into the patient such that the modified lymphocytes

Read More
Why is it that nitrogen is often a limiting plant nutrient,

Biology

Why is it that nitrogen is often a limiting plant nutrient,

Posted By Bruce Simons

Why is it that nitrogen is often a limiting plant nutrient, despite the fact that the atmosphere is… Show more Why is it that nitrogen is often a limiting plant nutrient, despite the fact that the atmosphere is 80% nitrogen gas (N2)? a. Because N2

Read More
Describe for each functional T cell subset, a) where inducti

Biology

Describe for each functional T cell subset, a) where inducti

Posted By Bruce Simons

Describe for each functional T cell subset, a) where induction occurs, b) what antigen they typicall… Show more Describe for each functional T cell subset, a) where induction occurs, b) what antigen they typically recognize, and c) how they contribute to tolerance? -Clonal anergy -pTregs

Read More
a) The pho… Show more Which of the statements about ACP an

Biology

a) The pho… Show more Which of the statements about ACP an

Posted By Bruce Simons

a) The pho… Show more Which of the statements about ACP and phosphopantetheine are true? Select all that apply. a) The phosphopantetheine cofactor is bound to adenosine in coenzyme A. b) The phosphopantetheine cofactor is bound to a Cys side chain of ACP. c) The

Read More
There is an enzyme in the citric acid cycle that is very sim

Biology

There is an enzyme in the citric acid cycle that is very sim

Posted By Bruce Simons

There is an enzyme in the citric acid cycle that is very similar to pyruvate dehydrogenase: it is a… Show more There is an enzyme in the citric acid cycle that is very similar to pyruvate dehydrogenase: it is a large enzyme complex with three

Read More
Provide 3 examples of potential ethical issues faced by reha

Biology

Provide 3 examples of potential ethical issues faced by reha

Posted By Bruce Simons

Provide 3 examples of potential ethical issues faced by rehabilitating then releasing marine mammal… Show more Provide 3 examples of potential ethical issues faced by rehabilitating then releasing marine mammals back to the wild • Show less

Read More
Given below is a processed, mature mRNA sequence correspondi

Biology

Given below is a processed, mature mRNA sequence correspondi

Posted By Bruce Simons

Given below is a processed, mature mRNA sequence corresponding to a short protein: CCAGGAUGACGCUAGCC… Show more Given below is a processed, mature mRNA sequence corresponding to a short protein: CCAGGAUGACGCUAGCCGCAGCGAGCCACUAGGAGGAUGAGGGACCUAAAAAAAAA How many amino acids will the protein translated from this mRNA sequence have? I got

Read More
to each other in seque… Show more In a DNA double helix, t

Biology

to each other in seque… Show more In a DNA double helix, t

Posted By Bruce Simons

to each other in seque… Show more In a DNA double helix, the two strands run in a(n) [x] direction, and are [y] to each other in sequence. I tried x-Opposite y-antiparallel and x-Opposite y-Complementary and both answers were wrong • Show less

Read More
i need an explanation,please

Biology

i need an explanation,please

Posted By Bruce Simons

i need an explanation,please

Read More