GATGCCCGTTAGT… Show more Use the following DNA sequence from an E. coli to answer questions 12-15. GATGCCCGTTAGTTAGTACCAGACCTTACTCTATTATTGCATGGTACGGAA CTACGGGCAATCAATCATGGTCTGGAATGAGATAATAACGTACCATGCCTT 12. During replication the replication fork moves from right to left on the sequence above and the top strand is replicated in fragments. What is the most 3′ base of the top strand? a. A b. T c. G d. C 13. The bottom strand of the molecule is used as a template for transcription. What is the first codon of the mRNA? a. AAG b. TTC c. GAC d. CTG e. AUG 14. How many amino acids will be in the translated mRNA? a. 10 b. 11 c. 12 d. 13 e. >14 15. On the top strand, find the 20 th base from the left. If a mutation occurs at this site and changes the 20 th base from the left on the top strand to a G (and the corresponding base on the bottom strand becomes a C), what kind of mutation would that be? a. synonymous transition b. synonymous transversion c. nonsynonymous transition d. nonsynonymous transversion e. nonsense Please Explain your answes. Also! For number 13, am I suppose to always assume that the first codon will always be a start codon like “AUG”. • Show less



