+1 (347) 474-1028 info@parlouressay.com

Sketch the defined protein that is coded by the following DN

Custom Essays biology Sketch the defined protein that is coded by the following DN

biology

Sketch the defined protein that is coded by the following DN

Sketch the defined protein that is coded by the following DNA base sequence: CCTGAAGGTACGTTAGTTGACAT… Show more Sketch the defined protein that is coded by the following DNA base sequence: CCTGAAGGTACGTTAGTTGACATGACG. (I believe it would be CCU.GAA.GGU.ACG.UUA.GUU.GAC.AUG.ACG) — please confirm. Remember that a short chain of amino acids “looks” like a string – and it’s flexible like a string too. If you allow half inch of the string to represent one amino acid, nine amino acids would make the string 4and half inches long. Note that cysteine likes to form a bond with any other nearby cysteine molecules it can find. If there are two cysteines in the peptide, bend the “string” in order to bring the two cysteins together. This might make the straight string of amino acids curve into an “O” or maybe a “6” depending on where the two cyseines are. Please don’t just use the yahoo answer already posted without being able to confirm its accuracy and with an explanation — the question seems to indicate this could have been drawn as a “O” — I’d prefer to see that sketch as it would provide me with a better understanding since I can’t seem to figure out how that would be done. C C U | G A A | G G U | A…—…G ………………..C C…………………A …………………….. G……………………G | U………………………U U………………………..A …………………………/ A……………………C | G………………..A ….U…………G ……U……/ • Show less

Order Now

Ready to try a high quality writing service? Get a discount here